Nrp1 Negatively Regulates PI3K/AKT Pathway to Inhibit the Activation of Lung Fibroblasts and Its Role in Mouse Pulmonary Fibrosis

Guocang Cheng¹², Yuanyuan Jia¹, Tingting Zhao²³, Ruixin Qi¹², Miaomiao Nian¹², Juan Chen¹²³*

¹Ningxia Key Laboratory of Clinical and Pathogenic Microorganisms, Institute of Medical Science, General Hospital of Ningxia Medical University, Yinchuan 750004, China
²The First Clinical Medical College of Ningxia Medical University, Yinchuan 750004, China
³Department of Respiratory and Critical Care Medicine, General Hospital of Ningxia Medical University, Yinchuan 750004, China

Corresponding author: Juan Chen, Professor/Doctoral supervisor; E-mail: chenjuan7419@163.com
Guocang Cheng and Yuanyuan Jia are co-first authors

Abstract

Background Idiopathic pulmonary fibrosis (IPF) has a complex pathogenesis, limited treatment options, and a poor prognosis. Therefore, identifying safe and effective therapeutic targets is crucial.

Objective To investigate the regulatory effect of Nrp1 on the activation of mouse pulmonary fibroblasts (MPFs) through the PI3K/AKT signaling pathway and the therapeutic effect and safety of recombinant Nrp1 protein on pulmonary fibrosis (PF) in mice.

Methods Datasets GSE150910, GSE218997, GSE173523, GSE47460, and GSE32537 were downloaded from the GEO database to analyze Nrp1 expression in lung tissues of PF mouse models and IPF patients, as well as the correlation between Nrp1 expression and pulmonary function parameters in IPF patients. A total of 45 IPF patients diagnosed in the Department of Respiratory and Critical Care Medicine and 29 healthy controls who underwent physical examinations in the health management center at General Hospital of Ningxia Medical University from 2022 to 2024 were selected. Cell-free RNA (cfRNA) sequencing was used to analyze Nrp1 expression levels in plasma of IPF patients and healthy controls and its diagnostic efficacy. MPFs were divided into control, transforming growth factor β1 (TGF-β1), Nrp1 overexpression, and TGF-β1+Nrp1 overexpression groups. TGF-β1 was used to induce MPFs activation, and the effects of Nrp1 overexpression on the PI3K/AKT pathway and expression of α-SMA, Vim, and Fn were detected. Thirty male C57BL/6J mice were randomly divided into control, bleomycin (BLM), and BLM+Nrp1 groups (n=10 per group). After establishing the mouse PF model, the BLM+Nrp1 group was intraperitoneally injected with 100 μg·kg⁻¹·d⁻¹ of recombinant Nrp1 protein for 20 consecutive days. HE and Masson staining were used to observe pathological changes in mouse lung tissues, and liver and kidney function indicators were evaluated. Western blot and immunohistochemistry were used to detect expression of α-SMA, Vim, and Fn in lung tissues. ELISA was used to measure Nrp1 levels in plasma and bronchoalveolar lavage fluid (BALF).

Results Compared with normal lung tissues, Nrp1 expression was decreased in lung tissues of PF mice and IPF patients (P<0.05), and Nrp1 expression was positively correlated with FEV1%, FVC%, and DLCO%. Nrp1 mRNA expression in plasma of IPF patients was significantly lower than that of healthy controls (P<0.05), and the area under the receiver operating characteristic curve of plasma Nrp1 for diagnosing IPF was 0.754 (95% CI = 0.634-0.874). Compared with the TGF-β1 group, the TGF-β1+Nrp1 overexpression group showed decreased ratios of p-PI3K/PI3K and p-AKT/AKT and decreased expression of α-SMA, Vim, and Fn (P<0.05). After intraperitoneal injection of recombinant Nrp1 protein, the pathological features of PF in mice were improved. There were no statistically significant differences in plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), blood urea nitrogen (BUN), and creatinine (CREA) among the control, BLM, and BLM+Nrp1 groups (P>0.05). Compared with the BLM group, the BLM+Nrp1 group showed decreased expression of α-SMA and Fn in lung tissues and increased Nrp1 levels in plasma and BALF (P<0.05).

Conclusion Nrp1 expression is decreased in lung tissues, plasma, and BALF of IPF patients. Nrp1 inhibits activation of mouse pulmonary fibroblasts by negatively regulating the PI3K/AKT signaling pathway. Intraperitoneal injection of recombinant Nrp1 protein can alleviate pulmonary fibrosis in mice and has systemic safety.

Keywords Pulmonary fibrosis; Neuropilin-1; Fibroblast activation; Recombinant Nrp1 protein

Introduction

Idiopathic pulmonary fibrosis (IPF) is a progressive, fatal interstitial lung disease characterized by abnormal fibroblast activation, excessive extracellular matrix (ECM) deposition, and destruction of lung architecture, with a median survival of only 3-5 years [1-3]. Currently approved clinical drugs (pirfenidone and nintedanib) can only slow the decline in lung function, cannot reverse the fibrotic process, and have limitations such as hepatotoxicity and gastrointestinal adverse reactions [4-7]. Therefore, exploring new pathogenic mechanisms and safe, effective therapeutic targets for IPF is crucial.

Neuropilin-1 (Nrp1) is a transmembrane glycoprotein receptor. Early research focused on its role in angiogenesis and axon guidance [8-10]. Recent studies have found that Nrp1 promotes fibrosis in the liver, kidney, and myocardium [11], but its role in pulmonary fibrosis (PF) remains unclear. In radiation-induced pulmonary fibrosis (RIPF) models, Nrp1 accelerates fibrosis by promoting M2 macrophage polarization and epithelial-mesenchymal transition (EMT) [12]. She et al. [13] showed that Nrp1 expression increases after ionizing radiation and promotes collagen deposition by regulating arginase 1 (Arg1) and other M2 macrophage markers; the antagonist EG00229 can significantly inhibit fibrosis. Other studies have reported that Nrp1 expression is significantly reduced in lung tissues of IPF patients and PF animal models and is closely correlated with impaired lung function [percentage of forced expiratory volume in one second predicted (FEV1%), percentage of forced vital capacity predicted (FVC%), and percentage of diffusing capacity for carbon monoxide predicted (DLCO%)] [14]. Shen et al. [15] found that Nrp1 specifically expressed in type 2 innate lymphoid cells (ILC2) in lung tissue is induced by transforming growth factor β1 (TGF-β1) and promotes fibrosis by enhancing interleukin-33/suppression of tumorigenicity 2 (IL-33/ST2) signaling.

The phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) signaling pathway is a core driver of PF, promoting IPF progression through fibroblast activation, EMT, and inflammatory responses. Recent studies have shown that Nrp1 overexpression enhances osimertinib resistance in non-small cell lung cancer by activating the PI3K/AKT pathway [16], and Nrp1 promotes angiogenesis and aggravates liver cirrhosis by upregulating vascular endothelial growth factor receptor 2 (VEGFR2) expression via the PI3K/AKT pathway [17], indicating that Nrp1 can regulate the PI3K/AKT pathway. Based on this, this study aims to verify the expression characteristics of Nrp1 in IPF patients and bleomycin (BLM) mouse models, explore whether Nrp1 directly regulates lung fibroblast activation through the PI3K/AKT pathway, and evaluate whether exogenous supplementation with recombinant Nrp1 protein can improve the fibrotic process and its safety, providing new insights for IPF pathogenesis and disease diagnosis research.

Methods

Study Subjects

A total of 45 IPF patients diagnosed in the Department of Respiratory and Critical Care Medicine at the General Hospital of Ningxia Medical University from 2022 to 2024 and 29 healthy controls who underwent physical examinations at the Health Management Center of the same hospital during the same period were selected. This study protocol was approved by the Ethics Committee of Ningxia Medical University (KYLL-2023-0516).

Inclusion criteria for IPF patients: (1) Diagnosis of IPF according to the latest American Thoracic Society/European Respiratory Society/Japanese Respiratory Society/Latin American Thoracic Society (ATS/ERS/JRS/ALAT) guidelines [18]; (2) Age > 50 years; (3) Exclusion of other known causes of interstitial lung disease, such as environmental exposure (dust, mold), drug toxicity, autoimmune diseases, etc.; (4) Ability to communicate verbally or in writing and complete study-related auxiliary examinations; (5) Signed informed consent: patients voluntarily participated in the study and understood its purpose and procedures.

Exclusion criteria for IPF patients: (1) Other types of interstitial lung disease: such as connective tissue disease-associated interstitial lung disease (CTD-ILD), non-specific interstitial pneumonia, hypersensitivity pneumonitis, sarcoidosis, etc.; (2) Severe systemic diseases: such as uncontrolled cardiovascular disease, liver or kidney failure; (3) Pregnant or lactating women; (4) Inability to cooperate with examinations or follow-up.

Inclusion criteria for healthy controls: (1) No history of respiratory or chronic lung disease; (2) Age and gender matched with IPF patients; (3) Voluntary provision of informed consent and compliance with study procedures.

Experimental Animals and Housing

Thirty wild-type C57BL/6J male mice (6-8 weeks old, body weight 18-22 g) were purchased from the Laboratory Animal Center of Ningxia Medical University and housed in SPF-grade animal facilities at (22±2)°C and (50±10)% humidity with a 12-hour light/dark cycle, with free access to standard rodent chow and sterilized water.

Experimental Cells

Mouse pulmonary fibroblasts (MPFs) were purchased from iCell Bioscience Inc. The construction and identification of Nrp1 overexpression plasmids were completed by Shanghai GeneChem Co., Ltd.

Reagents

BLM (IB0871) was purchased from Beijing Solarbio Science & Technology Co., Ltd. Antibodies against fibronectin (Fn, ab2413), α-smooth muscle actin (α-SMA, ab5694), vimentin (Vim, ab24525), and Nrp1 (ab81321) were purchased from Abcam. Antibodies against β-actin (10494-1-AP), glyceraldehyde-3-phosphate dehydrogenase (Gapdh, 60004-1-Ig), PI3K (60225-1-Ig), phosphorylated phosphatidylinositol 3-kinase (p-PI3K, 66444-1-Ig), and AKT (10176-2-AP) were purchased from Proteintech Group. Phosphorylated protein kinase B (p-AKT, T40116M) antibody was purchased from Abmart. Recombinant mouse TGF-β1 was purchased from R&D Systems (USA). Recombinant mouse Nrp1-Fc protein was purchased from MedChemExpress (USA). Bicinchoninic acid (BCA) protein assay kit (KGB2101-500) was purchased from Nanjing KeyGen Biotech Co., Ltd. Nrp1 enzyme-linked immunosorbent assay (ELISA) kit (JL54766) was purchased from Shanghai Jianglai Biotechnology Co., Ltd.

Experimental Procedures

Bioinformatics Analysis

Gene expression datasets GSE150910, GSE218997, GSE173523, GSE47460, and GSE32537 were downloaded from the Gene Expression Omnibus (GEO) database. R software was used for data cleaning, normalization, background correction, and differential analysis using the DESeq2 and limma packages, followed by data visualization.

Plasma cfRNA Sequencing

Fasting peripheral venous blood (5 mL) was collected from IPF patients and healthy controls using EDTA anticoagulation tubes. Plasma was collected after centrifugation at 3,000 r/min for 10 min at 4°C (radius 15 cm), then centrifuged at 16,000×g for 10 min at 4°C to remove cellular debris, aliquoted, and stored at -80°C before being sent to Shenzhen HaploX Biotechnology Co., Ltd. for cfRNA sequencing.

TGF-β1 Stimulation of Mouse MPFs Activation

Experiments were performed using MPFs at passages 3-5. MPFs were digested and seeded at 3×10⁵ cells/well in six-well plates. After 24 hours of culture when cells were completely adherent, they were divided into control and TGF-β1 groups. The control group was changed to complete medium, while the TGF-β1 group was changed to complete medium containing 10 ng/mL TGF-β1 and cultured for 24 h [19].

Nrp1 Overexpression Experiment

The experiment was divided into control, TGF-β1, Nrp1 overexpression, and TGF-β1+Nrp1 overexpression groups, with 3 replicates per group. Cells were seeded in six-well plates one day before transfection to ensure 60-80% confluence. For the Nrp1 overexpression and TGF-β1+Nrp1 overexpression groups: fresh complete medium was replaced, and 6 μg of Nrp1 overexpression plasmid was mixed with 6 μL of Advanced DNA transfection reagent, incubated for 15 min before adding to cells. After 24 h of transfection, medium was changed. Twelve hours later, the TGF-β1+Nrp1 overexpression and TGF-β1 groups were changed to complete medium containing 10 ng/mL TGF-β1, while the control and Nrp1 overexpression groups were changed to complete medium. After continued culture for 24 h, cells were collected for RNA and total protein extraction.

Construction of Recombinant Nrp1 Protein Therapy Mouse PF Model

Thirty male C57BL/6J mice were randomly divided into control, BLM, and BLM+Nrp1 groups (n=10 per group). A mouse PF model was established by intratracheal instillation of BLM, with the control group receiving equal volume of 0.9% sodium chloride. Starting on day 2 after modeling, mice in the BLM+Nrp1 group were intraperitoneally injected with 100 μg·kg⁻¹·d⁻¹ of recombinant Nrp1 protein for 21 consecutive days, while the control and BLM groups received equal volume of 0.9% sodium chloride. Mice were sacrificed after 21 days, and lung tissues, plasma, and bronchoalveolar lavage fluid (BALF) were collected [20]. This experimental protocol was approved by the Animal Ethics Committee of Ningxia Medical University (IACUC-NYLAC-2023-252).

HE Staining

Lung tissue sections from the control, BLM, and BLM+Nrp1 groups were deparaffinized, stained with hematoxylin, differentiated with hydrochloric acid ethanol, blued with bluing solution, stained with eosin, dehydrated with ethanol, cleared with xylene, and mounted with neutral resin.

Masson Staining [21]

Lung tissue sections from the control, BLM, and BLM+Nrp1 groups were deparaffinized, soaked in potassium dichromate overnight, washed with tap water, stained with a 1:1 mixture of iron hematoxylin A and B solutions, washed, differentiated with differentiation solution, washed, stained with ponceau acid fuchsin, washed, treated with phosphomolybdic acid, stained with aniline blue, differentiated with 1% acetic acid, dehydrated with two changes of absolute ethanol, cleared with xylene, mounted with neutral balsam, and examined under microscope with image acquisition and analysis.

Detection of Plasma Liver and Kidney Function Indicators: Alanine Aminotransferase (ALT), Aspartate Aminotransferase (AST), Alkaline Phosphatase (ALP), Blood Urea Nitrogen (BUN), and Creatinine (CREA)

Blood was collected from mice in the control, BLM, and BLM+Nrp1 groups, centrifuged at 3,000 r/min for 10 min at 4°C (radius 5 cm) to collect plasma. An automatic biochemical analyzer was used to detect biochemical parameters following the procedure: instrument self-check → reagent preparation (equilibration, entry) and sample preparation (centrifugation, inspection) → automatic sampling and reaction → optical monitoring of absorbance changes → result calculation → quality control review → report generation.

Immunohistochemical Staining

Lung tissue sections from the control, BLM, and BLM+Nrp1 groups were deparaffinized, subjected to antigen retrieval, blocked for endogenous peroxidase, serum-blocked, then incubated overnight with primary antibodies Nrp1 (1:250) and α-SMA (1:250). Secondary antibodies were added the next day, followed by DAB color development, nuclear counterstaining, dehydration, mounting, and analysis using a slide scanner.

Western Blotting Analysis

Mouse lung tissues and MPFs were lysed with RIPA lysis buffer, centrifuged to collect supernatant as total protein. After BCA concentration measurement, 20 μg protein was loaded, separated by SDS-PAGE, transferred to PVDF membrane, blocked with 5% skim milk at room temperature, and incubated with primary antibodies at 4°C. The next day, membranes were washed 3 times with TBST, incubated with corresponding secondary antibodies, treated with ECL luminescent solution, exposed using a protein imaging system, and gray values were calculated using Image J software to analyze expression levels of Nrp1, α-SMA, Vim, Fn, PI3K, p-PI3K, AKT, and p-AKT in mouse lung tissues and MPFs.

qRT-PCR

RNA was extracted using TRIzol and chloroform, reverse-transcribed to cDNA. Using Gapdh or β-actin as internal reference, relative mRNA expression levels were calculated using the 2^-ΔΔCt method. Primers were synthesized by Shanghai Sangon Biotech Co., Ltd., with sequences shown in Table 1 [TABLE:1].

Table 1 Primer sequences

Gene Gene ID Primer Sequence (5'-3') Length (bp) Nrp1 - F: CTCTCTCCACAAGGTTCATCAG
R: GTAGGTGCTTCCACTTCACA - Fn - F: GACTCATGGTGGCCACTAAATA
R: CTTCTTGGAGGGCTAACATTCT - α-SMA - F: TCAGGGAGTAATGGTTGGAATG
R: GGTGATGATGCCGTGTTCTA - Vimentin - F: CCCTGAACCTGAGAGAAACTAAC
R: CTCTGGTCTCAACCGTCTTAATC - Gapdh - F: GGTTGTCTCCTGCGACTTCA
R: TGGTCCAGGGTTTCTTACTCC - β-actin - F: TCATCCATGGCGAACTGGTG
R: AAGGAAGGCTGGAAAAGAGC -

Note: Nrp1 = Neuropilin-1, Fn = Fibronectin, α-SMA = α-smooth muscle actin, Gapdh = Glyceraldehyde-3-phosphate dehydrogenase, β-actin = β-actin.

ELISA

Nrp1 levels in plasma and BALF of mice from the control, BLM, and BLM+Nrp1 groups were detected according to the manufacturer's instructions.

Statistical Methods

Data were analyzed using GraphPad Prism 9.0 software. Normally distributed continuous variables were expressed as (mean ± standard deviation), compared between two groups using t-test, among multiple groups using one-way ANOVA, with pairwise comparisons using LSD-t test. Non-normally distributed continuous variables were expressed as median (P25, P75) and compared using non-parametric tests. Receiver operating characteristic (ROC) curve for plasma Nrp1 in diagnosing IPF was plotted. P<0.05 was considered statistically significant.

Results

2.1 Analysis of Nrp1 Expression in GEO Public Datasets and Correlation with Pulmonary Function Parameters

Analysis of dataset GSE150910 showed that Nrp1 gene expression levels in lung tissues of IPF patients were lower than in normal lung tissues (P<0.05) (Figure 1 [FIGURE:1]A). Analysis of datasets GSE218997 and GSE173523 revealed that Nrp1 gene expression levels in lung tissues of BLM-induced fibrosis model mice were lower than in normal lung tissues (P<0.05) (Figure 1B, 1C). Analysis of datasets GSE47460 and GSE32537 demonstrated that Nrp1 gene expression levels in BALF of IPF patients were positively correlated with DLCO%, FEV1%, and FVC% (Figure 1D-1H).

2.2 Comparison of Baseline Clinical Characteristics Between IPF Patients and Healthy Controls

Among healthy controls, there were 18 males and 11 females with a median age of 63 years; among IPF patients, there were 27 males and 18 females with a median age of 66 years. No statistically significant differences were found in gender, age, BMI, or total lung capacity (TLC) between the two groups (P>0.05). IPF patients had significantly lower FVC, FVC%, TLC%, and DLCO% compared with healthy controls (P<0.05), as shown in Table 2 [TABLE:2].

Table 2 [TABLE:2] Comparison of baseline characteristics between patients with idiopathic pulmonary fibrosis and healthy controls

Characteristic Healthy Controls (n=29) IPF Patients (n=45) Test Statistic P-value Gender (male/female) 18/11 27/18 χ² = 0.032 >0.05 Age [M(P25,P75), years] 63 (61, 67) 66 (62, 70) U = 539.000 <0.001 BMI (kg/m²) 25.14 ± 3.11 25.08 ± 2.49 t = 0.087 >0.05 FVC (L) 3.60 ± 0.70 2.80 ± 0.68 t = 5.180 <0.001 FVC% [M(P25,P75)] 111.50 (88.45, 120.25) 79.50 (69.00, 90.00) U = 86.000 <0.001 TLC (L) 5.18 ± 0.86 4.48 ± 0.86 t = 3.600 <0.001 TLC% [M(P25,P75)] 92.48 ± 3.43 71.81 ± 11.70 U = 8.000 <0.001 DLCO% [M(P25,P75)] 92.50 (84.80, 104.75) 53.00 (44.00, 64.00) U = 8.000 <0.001

Note: FVC = forced vital capacity, FVC% = percentage of forced vital capacity predicted, TLC = total lung capacity, TLC% = percentage of total lung capacity predicted, DLCO% = percentage of diffusing capacity for carbon monoxide predicted.

2.3 Nrp1 Expression in Plasma of IPF Patients and Healthy Controls and Its Diagnostic Efficacy

By analyzing cfRNA sequencing data from plasma of IPF patients and healthy controls using P<0.05 and |log2FC|>1 as screening criteria, results showed that Nrp1 mRNA expression levels in plasma of IPF patients were significantly lower than those in healthy controls (P<0.05) (Figure 2A and 2B). ROC curve analysis revealed that the area under the curve (AUC) of plasma Nrp1 for diagnosing IPF was 0.754 (95% CI = 0.634-0.874) (Figure 2 [FIGURE:2]C).

2.4 Effect of Nrp1 Overexpression on Expression of Activation-Related Molecules in MPFs

Western blotting and qRT-PCR results showed statistically significant differences in protein and gene expression levels of α-SMA, Vim, Fn, and Nrp1 among the four groups (P<0.05). Compared with the control group, the TGF-β1 group showed increased protein and gene expression levels of α-SMA and Fn and decreased Nrp1 protein and gene expression levels. Compared with the control group, the Nrp1 overexpression group showed decreased protein and gene expression levels of α-SMA, Vim, and Fn and increased Nrp1 protein and gene expression levels. Compared with the TGF-β1 group, the TGF-β1+Nrp1 overexpression group showed decreased gene and protein expression of α-SMA, Vim, and Fn and increased Nrp1 protein and gene expression levels, with all differences being statistically significant (P<0.05), as shown in Figure 3 [FIGURE:3] and Tables 3-4 [TABLE:3][TABLE:4].

Table 3 Comparison of mRNA expression levels of α-SMA, Vim, Fn and Nrp1 in the control group, TGF-β1 group, Nrp1 overexpression group and TGF-β1+Nrp1 overexpression group

Gene Control TGF-β1 Group Nrp1 Overexpression Group TGF-β1+Nrp1 Overexpression Group P-value α-SMA 1.000 ± 0.016 1.378 ± 0.105ᵃ 0.801 ± 0.067ᵃ 0.703 ± 0.021ᵇ <0.0001 Vim 1.000 ± 0.065 1.003 ± 0.026 0.844 ± 0.041ᵃ 0.866 ± 0.037ᵇ <0.0001 Fn 1.000 ± 0.020 2.508 ± 0.061ᵃ 0.592 ± 0.009ᵃ 0.779 ± 0.067ᵇ <0.0001 Nrp1 1.000 ± 0.050 0.294 ± 0.010ᵃ 2.132 ± 0.015ᵃ 0.612 ± 0.053ᵇ <0.0001

Note: ᵃ indicates P<0.05 compared with control group, ᵇ indicates P<0.05 compared with TGF-β1 group.

Table 4 [TABLE:4] Comparison of protein expression levels of α-SMA, Vim, Fn and Nrp1 in the control group, TGF-β1 group, Nrp1 overexpression group and TGF-β1+Nrp1 overexpression group

Protein Control TGF-β1 Group Nrp1 Overexpression Group TGF-β1+Nrp1 Overexpression Group P-value α-SMA 1.000 ± 0.035 1.396 ± 0.014ᵃ 0.136 ± 0.029ᵃ 0.349 ± 0.032ᵇ <0.0001 Vim 1.000 ± 0.019 1.101 ± 0.023 0.553 ± 0.035ᵃ 0.668 ± 0.037ᵇ <0.0001 Fn 1.000 ± 0.022 1.546 ± 0.039ᵃ 0.185 ± 0.006ᵃ 0.268 ± 0.006ᵇ <0.0001 Nrp1 1.000 ± 0.030 0.744 ± 0.042ᵃ 1.368 ± 0.023ᵃ 1.394 ± 0.026ᵇ <0.0001

Note: ᵃ indicates P<0.05 compared with control group, ᵇ indicates P<0.05 compared with TGF-β1 group.

2.5 Effect of Nrp1 Overexpression on the PI3K/AKT Pathway in MPFs

To investigate whether Nrp1 regulates mouse MPFs activation through the PI3K/AKT pathway, Western blotting was used to detect the effects of Nrp1 overexpression on PI3K, p-PI3K, AKT, and p-AKT proteins. Results showed statistically significant differences in p-PI3K/PI3K and p-AKT/AKT ratios among the four groups (P<0.05). Compared with the control group, the TGF-β1 group showed increased p-PI3K/PI3K and p-AKT/AKT ratios. Compared with the control group, the Nrp1 overexpression group showed decreased p-PI3K/PI3K ratio. Compared with the TGF-β1 group, the TGF-β1+Nrp1 overexpression group showed decreased p-PI3K/PI3K and p-AKT/AKT ratios, with all differences being statistically significant (P<0.05), as shown in Figure 4 [FIGURE:4] and Table 5 [TABLE:5].

Table 5 Comparison of protein expression levels of p-PI3K/PI3K and p-AKT/AKT in the control group, TGF-β1 group, Nrp1 overexpression group and TGF-β1+Nrp1 overexpression group

Protein Ratio Control TGF-β1 Group Nrp1 Overexpression Group TGF-β1+Nrp1 Overexpression Group P-value p-PI3K/PI3K 1.000 ± 0.009 2.900 ± 0.171ᵃ 0.687 ± 0.121ᵃ 0.820 ± 0.013ᵇ <0.0001 p-AKT/AKT 1.000 ± 0.006 1.429 ± 0.060ᵃ 0.935 ± 0.023 0.915 ± 0.036ᵇ <0.0001

Note: ᵃ indicates P<0.05 compared with control group, ᵇ indicates P<0.05 compared with TGF-β1 group.

2.6 Effect of Recombinant Nrp1 Protein on Pathological Morphology in PF Mice

HE staining showed that the lung tissue structure was intact in the control group, while the BLM group exhibited severe alveolar structure destruction with inflammatory cell infiltration and thickened alveolar walls; these pathological features were significantly improved after recombinant Nrp1 intervention. Masson staining showed that the BLM group had fused alveolar structures with massive collagen deposition, while Nrp1 treatment reduced collagen deposition, suggesting that recombinant Nrp1 can improve PF pathological features and reduce collagen deposition (Figure 5 [FIGURE:5]).

2.7 Plasma Levels of ALT, AST, ALP, BUN, and CREA in Mice

No statistically significant differences were found in plasma levels of ALT, AST, ALP, BUN, and CREA among the control, BLM, and BLM+Nrp1 groups (P>0.05), as shown in Table 6 [TABLE:6].

Table 6 Comparison of levels of ALT, AST, ALP, BUN and CREA in the plasma of mice among the control group, BLM group and BLM+Nrp1 group

Parameter Control (n=10) BLM Group (n=10) BLM+Nrp1 Group (n=10) F(Z) value P-value ALT (U/L) 33.350 ± 5.639 23.275 ± 5.010 39.400 ± 25.549 2.100ᵃ >0.05 AST (U/L) 93.150 ± 7.490 105.820 ± 19.032 105.650 ± 14.389 2.100ᵃ >0.05 ALP (U/L) 81.500 ± 34.857 89.750 ± 42.680 96.250 ± 25.171 2.100ᵃ >0.05 BUN [M(P25,P75), mmol/L] 9.000 (8.475, 9.800) 7.800 (7.450, 7.825) 8.450 (7.500, 9.250) 2.100ᵃ >0.05 CREA (μmol/L) 13.925 ± 1.992 14.075 ± 2.824 13.475 ± 0.801 2.100ᵃ >0.05 BUN/CREA 0.677 ± 0.132 0.553 ± 0.148 0.619 ± 0.133 2.100ᵃ >0.05

Note: ᵃ indicates Z value.

2.8 Effect of Recombinant Nrp1 Protein on Expression of α-SMA, Vim, and Fn in Lung Tissues of PF Mice

Immunohistochemistry results showed that α-SMA increased in mouse lung tissues after BLM induction, while injection of recombinant Nrp1 decreased α-SMA expression, indicating that Nrp1 can effectively inhibit myofibroblast activation. Additionally, compared with the control group, a small number of Nrp1-positive brown-yellow areas were visible in lung tissues of the BLM group, while Nrp1-positive expression increased after Nrp1 treatment (Figure 6 [FIGURE:6]).

Western blotting results showed statistically significant differences in protein expression levels of α-SMA, Vim, Fn, and Nrp1 in lung tissues among the control, BLM, and BLM+Nrp1 groups (P<0.05). Compared with the control group, the BLM group showed decreased Nrp1 protein expression and increased α-SMA, Vim, and Fn protein expression levels in lung tissues. Compared with the BLM group, the BLM+Nrp1 group showed decreased Fn expression levels, with all differences being statistically significant (P<0.05), as shown in Figure 7 [FIGURE:7] and Table 7 [TABLE:7].

Table 7 Comparison of protein expression levels of α-SMA, Vim, Fn and Nrp1 in the lung tissue of mice among the control group, BLM group and BLM+Nrp1 group

Protein Control (n=10) BLM Group (n=10) BLM+Nrp1 Group (n=10) P-value α-SMA 1.000 ± 0.181 1.875 ± 0.268ᵃ 1.404 ± 0.440 <0.0001 Vim 1.000 ± 0.250 2.602 ± 0.051ᵃ 2.317 ± 0.215 <0.0001 Fn 1.000 ± 0.597 12.650 ± 0.893ᵃ 6.365 ± 3.043ᵇ <0.0001 Nrp1 1.000 ± 0.209 0.363 ± 0.067ᵃ 0.564 ± 0.379 <0.0001

Note: ᵃ indicates P<0.05 compared with control group, ᵇ indicates P<0.05 compared with BLM group.

2.9 Effect of Recombinant Nrp1 Protein on Nrp1 Levels in BALF and Plasma of PF Mice

Statistically significant differences were found in Nrp1 levels in BALF and plasma among the control, BLM, and BLM+Nrp1 groups (P<0.05). Compared with the control group, the BLM group showed decreased Nrp1 levels in both BALF and plasma. Compared with the BLM group, the BLM+Nrp1 group showed increased Nrp1 levels in both BALF and plasma, with statistically significant differences (P<0.05), as shown in Table 8 [TABLE:8].

Table 8 Comparison of Nrp1 levels in BALF and plasma of mice among the control group, BLM group and BLM+Nrp1 group

Sample Control (n=10) BLM Group (n=10) BLM+Nrp1 Group (n=10) P-value BALF Nrp1 (pg/mL) 482.588 ± 41.03 292.586 ± 38.597ᵃ 591.949 ± 79.132ᵇ <0.0001 Plasma Nrp1 (pg/mL) 442.518 ± 34.359 205.975 ± 97.804ᵃ 501.745 ± 147.847ᵇ <0.0001

Note: ᵃ indicates P<0.05 compared with control group, ᵇ indicates P<0.05 compared with BLM group; BALF = bronchoalveolar lavage fluid.

Discussion

This study integrated multiple GEO datasets and found that Nrp1 gene expression was downregulated in lung tissues of both IPF patients and BLM-induced mouse PF models, consistent with previous reports [14]. In BALF of IPF patients, Nrp1 expression was positively correlated with pulmonary function parameters (DLCO%, FEV1%, FVC%), suggesting that Nrp1 may influence lung function by regulating lung tissue repair and fibrotic processes, with mechanisms requiring in-depth analysis combined with cell type specificity. The consistent low expression of Nrp1 in IPF and BLM models reflects its protective role in maintaining lung tissue homeostasis. ZHANG et al. [15] found that TGF-β1-Nrp1 signaling in lung tissue accelerates fibrosis by upregulating IL-33 receptor ST2 expression and enhancing type 2 innate lymphoid cell (ILC2) function, whereas Nrp1 deletion in alveolar epithelial cells alleviates EMT [22]. This cell type-dependent functional differentiation explains contradictory phenomena in different models: in radiation-induced pulmonary fibrosis (RIPF) models, Nrp1 promotes EMT by enhancing Wnt/β-catenin and TGF-β1/Smads signaling [22], while BLM/IPF models are dominated by fibroblast activation, where low Nrp1 expression weakens its anti-fibrotic function. The strong correlation between Nrp1 expression and DLCO% has important clinical significance. DLCO% reflects the gas exchange efficiency of the alveolar-capillary membrane, and as an angiogenesis regulator, low Nrp1 expression may lead to reduced microvascular density, directly impairing gas exchange [23].

Through high-throughput sequencing of cfRNA expression profiles in plasma of IPF patients, we found that Nrp1 mRNA expression levels were downregulated in IPF patients, and this reduced expression possessed certain discriminatory ability for IPF diagnosis (AUC=0.754). This finding not only provides a new potential biomarker for non-invasive diagnosis of IPF but also suggests that Nrp1 may participate in the pathophysiological regulatory network of IPF, warranting further exploration of its biological significance and clinical application potential. As a receptor for Semaphorin 3A, Nrp1 is involved in the regulation of alveolar epithelial cell migration and injury repair, and its reduced expression may impair epithelial barrier repair capacity, leading to persistent repeated micro-injuries, which are the initiating factors of IPF [24]. Late-stage IPF is often accompanied by destruction of the pulmonary vascular system and abnormal angiogenesis. As a co-receptor for vascular endothelial growth factor (VEGF), Nrp1 downregulation may interfere with normal vascular homeostasis, promote pathological vascular remodeling, and accelerate the fibrotic process [25]. The diagnostic efficacy of plasma Nrp1 mRNA for IPF (AUC=0.754) indicates moderate discriminatory ability. Compared with traditional clinical indicators such as KL-6 (AUC approximately 0.85) or high-resolution CT (HRCT) visual scoring, the diagnostic value of Nrp1 alone is slightly lower, but its advantages lie in easy collection of plasma samples for dynamic monitoring and PCR-based detection technology that is convenient for clinical promotion.

Lung fibroblasts are important effector cells in pulmonary fibrosis, and their proliferation and activation during the fibrotic process are crucial. TGF-β1 is a key pro-fibrotic cytokine that can promote fibroblast activation, induce differentiation into myofibroblasts, and promote ECM protein synthesis and deposition. In vitro experiments comparing molecular expression characteristics among control, TGF-β1, and TGF-β1+Nrp1 overexpression groups under TGF-β1 stimulation revealed that Nrp1 inhibits mouse lung fibroblast activation and abnormal ECM deposition by negatively regulating the PI3K/AKT signaling pathway. Specifically, TGF-β1 stimulation caused synchronous downregulation of Nrp1 gene and protein expression, concurrently activated the PI3K/AKT pathway, and upregulated expression of the core fibroblast activation marker α-SMA and the key ECM scaffold protein fibronectin Fn. In contrast, Nrp1 overexpression effectively reversed these processes, significantly reducing p-PI3K/PI3K, p-AKT/AKT, and fibroblast marker levels. This finding not only deepens our understanding of ECM remodeling mechanisms in fibrotic diseases but also provides new insights for targeted intervention.

Treatment of PF mice via intraperitoneal injection of recombinant Nrp1 protein improved lung pathological features, reduced expression of myofibroblast marker α-SMA and Fn in lung tissues, and concurrently increased local Nrp1 levels in the lung. Notably, plasma liver and kidney function indicators (ALT, AST, ALP, BUN, CREA) showed no significant fluctuations during treatment, while Nrp1 levels in BALF increased, suggesting that exogenous Nrp1 can be effectively delivered to lung tissue and exert anti-fibrotic effects. Combined with the observation that TGF-β1 stimulation significantly downregulates Nrp1 expression in MPFs while activating the PI3K/AKT pathway and inducing α-SMA and Fn synthesis, we speculate that exogenous Nrp1 may competitively bind TGF-β1, thereby blocking downstream PI3K/AKT phosphorylation. This study provides a new therapeutic approach for targeting Nrp1 in pulmonary fibrosis, though its mechanisms and clinical potential require in-depth analysis with multi-dimensional evidence.

This study has several limitations. First, the sample size is small and lacks population stratification: the cohort sample size is relatively limited, and no stratified analysis was performed according to IPF subtypes (such as stable phase vs acute exacerbation), which may obscure associations between Nrp1 expression and specific clinical phenotypes. Second, there is a lack of diagnostic specificity validation: this study did not include other interstitial lung diseases (such as CTD-ILD) as controls, making it difficult to evaluate the diagnostic specificity of Nrp1 for IPF.

In summary, this study confirms that Nrp1 expression is decreased in lung tissues, plasma, and BALF of IPF patients. Nrp1 inhibits activation of mouse pulmonary fibroblasts by negatively regulating the PI3K/AKT signaling pathway. Additionally, intraperitoneal injection of recombinant Nrp1 protein can alleviate pulmonary fibrosis in mice with systemic safety. The findings of this study not only deepen our understanding of the heterogeneous mechanisms of IPF but also provide experimental basis for developing precision therapeutic strategies targeting Nrp1. Management of pulmonary fibrosis requires joint participation from respiratory medicine, radiology, pathology, rheumatology and immunology (for some cases secondary to connective tissue disease), and general practitioners. As a new biomarker and therapeutic target, Nrp1 provides new content and basis for multidisciplinary team (MDT) discussions. Understanding the value of Nrp1-related research can help general practitioners quickly integrate specialist treatment opinions, rehabilitation plans, long-term follow-up monitoring (such as regular testing of plasma Nrp1 trends), and symptom management to ensure continuous, integrated care for patients with pulmonary fibrosis.

References

[1] WAN R Y, WANG L, DUAN Y D, et al. ADRB2 inhibition combined with antioxidant treatment alleviates lung fibrosis by attenuating TGFβ/SMAD signaling in lung fibroblasts[J]. Cell Death Discov, 2023, 9(1): 407. DOI: 10.1038/s41420-023-01621-5.

[2] ZABIHI M, SHAHRIARI FELORDI M, LINGAMPALLY A, et al. Understanding myofibroblast origin in the fibrotic lung[J]. Chin Med J Pulm Crit Care Med, 2024, 2(3): 142-150. DOI: 10.1016/j.pccm.2024.08.003.

[3] VÁSQUEZ-PACHECO E, MAREGA M, LINGAMPALLY A, et al. Highlighting fibroblast plasticity in lung fibrosis: the WI-38 cell line as a model for investigating the myofibroblast and lipofibroblast switch[J]. Theranostics, 2024, 14(9): 3603-3622. DOI: 10.7150/thno.93519.

[4] GLASS D S, GROSSFELD D, RENNA H A, et al. Idiopathic pulmonary fibrosis: Current and future treatment[J]. Clin Respir J, 2022, 16(2): 84-96. DOI: 10.1111/crj.13466.

[5] MA J, LI G, WANG H, et al. Comprehensive review of potential drugs with anti-pulmonary fibrosis properties[J]. Biomed Pharmacother, 2024, 173: 116282. DOI: 10.1016/j.biopha.2024.116282.

[6] BARRATT S L, MULHOLLAND S, AL JBOUR K, et al. South-west of England's experience of the safety and tolerability pirfenidone and nintedanib for the treatment of idiopathic pulmonary fibrosis (IPF)[J]. Front Pharmacol, 2018, 9: 1480. DOI: 10.3389/fphar.2018.01480.

[7] GULATI S, LUCKHARDT T R. Updated evaluation of the safety, efficacy and tolerability of pirfenidone in the treatment of idiopathic pulmonary fibrosis[J]. Drug Healthc Patient Saf, 2020, 12: 85-94. DOI: 10.2147/DHPS.S224007.

[8] BROZ M, KOLARIČ A, JUKIČ M, et al. Neuropilin (NRPs) related pathological conditions and their modulators[J]. Int J Mol Sci, 2022, 23(15): 8402. DOI: 10.3390/ijms23158402.

[9] VALDEMBRI D, REGANO D, MAIONE F, et al. Class 3 semaphorins in cardiovascular development[J]. Cell Adh Migr, 2016, 10(6): 641-651. DOI: 10.1080/19336918.2016.1212805.

[10] KAZEMI M, CARRER A, MOIMAS S, et al. VEGF121 and VEGF165 differentially promote vessel maturation and tumor growth in mice and humans[J]. Cancer Gene Ther, 2016, 23(5): 125-132. DOI: 10.1038/cgt.2016.12.

[11] ZHAO J Q, BAI J, PENG F L, et al. USP9X-mediated NRP1 deubiquitination promotes liver fibrosis by activating hepatic stellate cells[J]. Cell Death Dis, 2023, 14(1): 40. DOI: 10.1038/s41419-022-05527-9.

[12] YI J X, GAO H, WEI X F, et al. The transcription factor GATA3 positively regulates NRP1 to promote radiation-induced pulmonary fibrosis[J]. Int J Biol Macromol, 2024, 262(Pt 2): 130052. DOI: 10.1016/j.ijbiomac.2024.130052.

[13] 佘炜，魏江，董丹丹，等. NRP1 调控 M2 型巨噬细胞极化介导电离辐射肺纤维化的作用研究[J]. 中国免疫学杂志, 2023, 39(2): 252-256. DOI: 10.3969/j.issn.1000-484X.2023.02.005.

[14] YOMBO D J K, GHANDIKOTA S, VEMULAPALLI C P, et al. SEMA3B inhibits TGFβ-induced extracellular matrix protein production and its reduced levels are associated with a decline in lung function in IPF[J]. Am J Physiol Cell Physiol, 2024, 326(6): C1659-C1668. DOI: 10.1152/ajpcell.00681.2023.

[15] ZHANG J J, QIU J X, ZHOU W Y, et al. Neuropilin-1 mediates lung tissue-specific control of ILC2 function in type 2 immunity[J]. Nat Immunol, 2022, 23(2): 237-250. DOI: 10.1038/s41590-021-01097-8.

[16] EVYAPAN G, SENTURK N C, CELIK I S. Correction: ornidazole inhibits the angiogenesis and migration abilities of non-small cell lung cancer (NSCLC) via downregulation of VEGFA/VEGFR2/NRP-1 and PI3K/AKT/mTOR pathways[J]. Cell Biochem Biophys, 2025, 83(1): 1325. DOI: 10.1007/s12013-024-01466-5.

[17] WANG L, FENG Y M, XIE X Y, et al. Neuropilin-1 aggravates liver cirrhosis by promoting angiogenesis via VEGFR2-dependent PI3K/Akt pathway in hepatic sinusoidal endothelial cells[J]. EBioMedicine, 2019, 43: 525-536. DOI: 10.1016/j.ebiom.2019.04.050.

[18] RAGHU G, REMY-JARDIN M, MYERS J L, et al. Diagnosis of idiopathic pulmonary fibrosis. an official ATS/ERS/JRS/ALAT clinical practice guideline[J]. Am J Respir Crit Care Med, 2018, 198(5): e44-e68. DOI: 10.1164/rccm.201807-1255ST.

[19] FARKAS L, HOROWITZ J C, MORA A L. How a fibroblast ages: a role for bone morphogenetic protein 4 in protecting lung fibroblasts from senescence in pulmonary fibrosis[J]. Eur Respir J, 2022, 60(6): 2201702. DOI: 10.1183/13993003.01702-2022.

[20] NG B, DONG J R, D'AGOSTINO G, et al. Interleukin-11 is a therapeutic target in idiopathic pulmonary fibrosis[J]. Sci Transl Med, 2019, 11(511): eaaw1237. DOI: 10.1126/scitranslmed.aaw1237.

[21] 梅倩茹. 抑制剂 XI-011 靶向 MDM4 治疗特发性肺纤维化[D]. 武汉: 华中科技大学, 2024.

[22] 董卓. NRP1 基因特异性敲除对放射性肺纤维化进程的影响及其作用机制[D]. 长春: 吉林大学, 2020.

[23] FU J W, HE J Y, ZHANG L M, et al. Comprehensive analysis and immunohistochemistry localization of NRP1 expression in pancancer and normal individual tissues in relation to SARS-CoV-2 susceptibility[J]. Exp Ther Med, 2023, 27(2): 52. DOI: 10.3892/etm.2023.12340.

[24] WANG H T, SUN K, PENG H, et al. Emerging roles of noncoding RNAs in idiopathic pulmonary fibrosis[J]. Cell Death Discov, 2024, 10(1): 443. DOI: 10.1038/s41420-024-02170-5.

[25] LIU C, SOMASUNDARAM A, MANNE S, et al. Neuropilin-1 is a T cell memory checkpoint limiting long-term antitumor immunity[J]. Nat Immunol, 2020, 21(9): 1010-1021. DOI: 10.1038/s41590-020-0733-2.

Author Contributions

Guocang Cheng was responsible for animal experiments, data collection, figure preparation, and manuscript drafting. Yuanyuan Jia was responsible for cell and molecular biology experiments, data analysis, and final version revision. Tingting Zhao, Ruixin Qi, and Miaomiao Nian were responsible for clinical blood sample collection and processing. Juan Chen was responsible for quality control and review of the article and takes overall responsibility for the article.

This article has no conflict of interest.

(Received date: 2025-04-10; Revised date: 2025-07-31)
(This article was edited: Jia Mengmeng)